Sequence retrieval

Genome: Alteromonas macleodii Deep ecotype
Start position: 1951157
End position: 1951186
Length: 30

DNA sequence
>NC_011138, from 1951157 to 1951186 (30 bp); Alteromonas macleodii Deep ecotype GCGACGACAACAGACGACAAACGACGTCAA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1950597-1951583	Sequence	MADE_1008885 - small-conductance mechanosensitive channel (Protein is coded in complementary strand; from 1951583 to 1950597)