Sequence retrieval

Genome: Alteromonas macleodii Deep ecotype
Start position: 2106287
End position: 2106313
Length: 27

DNA sequence
>NC_011138, from 2106287 to 2106313 (27 bp); Alteromonas macleodii Deep ecotype TACACACTTTACACACTTTACACATTT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2105528-2106550	Sequence	MADE_1009575 - putative sugar-binding protein (Protein is coded in complementary strand; from 2106550 to 2105528)