Sequence retrieval

Genome: Alteromonas macleodii Deep ecotype
Start position: 2385364
End position: 2385390
Length: 27

DNA sequence
>NC_011138, from 2385364 to 2385390 (27 bp); Alteromonas macleodii Deep ecotype TTCTTTTTCTTCTTTTTGTTGTTTTTC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2385236-2386276	Sequence	MADE_1010880 - phosphoribosylaminoimidazole synthetase