Sequence retrieval

Genome: Alteromonas macleodii Deep ecotype
Start position: 2763038
End position: 2763082
Length: 45

DNA sequence
>NC_011138, from 2763038 to 2763082 (45 bp); Alteromonas macleodii Deep ecotype TTGCTTCTCTCGTTAATGCATCTCTCGTAAATGCATCTCTCGTAA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2762038-2763555	Sequence	MADE_1012675 - MviN protein (Protein is coded in complementary strand; from 2763555 to 2762038)