Sequence retrieval

Genome: Alteromonas macleodii Deep ecotype
Start position: 2889994
End position: 2890033
Length: 40

DNA sequence
>NC_011138, from 2889994 to 2890033 (40 bp); Alteromonas macleodii Deep ecotype CTGACTTGCTGACTTGCTGACTTGCTGACTTGCTGACTTG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2889928-2892066	Sequence	MADE_1013230 - methyl-accepting chemotaxis protein