Sequence retrieval

Genome: Alteromonas macleodii Deep ecotype
Start position: 3198214
End position: 3198240
Length: 27

DNA sequence
>NC_011138, from 3198214 to 3198240 (27 bp); Alteromonas macleodii Deep ecotype TAACGCCTTTAACGCCTTTAACGCCTT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3195973-3199269	Sequence	MADE_1014530 - PKD domain-containing protein (Protein is coded in complementary strand; from 3199269 to 3195973)