Sequence retrieval

Genome: Alteromonas macleodii Deep ecotype
Start position: 3708629
End position: 3708676
Length: 48

DNA sequence
>NC_011138, from 3708629 to 3708676 (48 bp); Alteromonas macleodii Deep ecotype ACCTGTATCGCCACCAGTATCGCCACCAGTATCACCACCAGTGTCGCC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3707959-3708771	Sequence	MADE_1017070 - hypothetical protein (Protein is coded in complementary strand; from 3708771 to 3707959)