Sequence retrieval

Genome: Alteromonas macleodii Deep ecotype
Start position: 3817806
End position: 3817829
Length: 24

DNA sequence
>NC_011138, from 3817806 to 3817829 (24 bp); Alteromonas macleodii Deep ecotype CTTCCGCTTGCGCTTGCGCTTTCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3816738-3817973	Sequence	MADE_1017565 - diguanylate phosphodiesterase (Protein is coded in complementary strand; from 3817973 to 3816738)