Sequence retrieval

Genome: Alteromonas macleodii Deep ecotype
Start position: 4008267
End position: 4008320
Length: 54

DNA sequence
>NC_011138, from 4008267 to 4008320 (54 bp); Alteromonas macleodii Deep ecotype GCGACTCGCTCAGGGCTGCATACTCGCTCAGGGCTGCATACTCGCTCAGGGCTG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 4007800-4009434	Sequence	MADE_1018450 - Glutamate decarboxylase putative (Protein is coded in complementary strand; from 4009434 to 4007800)