Sequence retrieval

Genome: Alteromonas macleodii Deep ecotype
Start position: 4072906
End position: 4072953
Length: 48

DNA sequence
>NC_011138, from 4072906 to 4072953 (48 bp); Alteromonas macleodii Deep ecotype ATGAACATGAACATGAACATGAACATGAACATGAACATGAACATGAAC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 4071679-4073733	Sequence	MADE_1018735 - putative soluble lytic murein transglycosylase (Protein is coded in complementary strand; from 4073733 to 4071679)