Sequence retrieval

Genome: Alteromonas macleodii Deep ecotype
Start position: 4222668
End position: 4222694
Length: 27

DNA sequence
>NC_011138, from 4222668 to 4222694 (27 bp); Alteromonas macleodii Deep ecotype CATGCCGCCCATTCCGCCCATGCCGCC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 4222442-4223482	Sequence	MADE_1019465 - YvaA protein (Protein is coded in complementary strand; from 4223482 to 4222442)