Sequence retrieval

Genome: Alteromonas macleodii Deep ecotype
Start position: 563614
End position: 563649
Length: 36

DNA sequence
>NC_011138, from 563614 to 563649 (36 bp); Alteromonas macleodii Deep ecotype TCCTTTTAAGCGTCTTTTTAGGCGTCTTTTTAAGCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 562764-564275	Sequence	MADE_1002555 - DamX-like protein (Protein is coded in complementary strand; from 564275 to 562764)