Sequence retrieval

Genome: Alteromonas macleodii Deep ecotype
Start position: 590034
End position: 590060
Length: 27

DNA sequence
>NC_011138, from 590034 to 590060 (27 bp); Alteromonas macleodii Deep ecotype TGGTATGCTTGGTATGCATGGTACGCT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 589687-590700	Sequence	MADE_1002665 argC N-acetyl-gamma-glutamyl-phosphate reductase (Protein is coded in complementary strand; from 590700 to 589687)