Sequence retrieval

Genome: Bifidobacterium longum subsp. infantis ATCC 15697
Start position: 1134777
End position: 1134800
Length: 24

DNA sequence
>NC_011593, from 1134777 to 1134800 (24 bp); Bifidobacterium longum subsp. infantis ATCC 15697 TGACGAAGACGATGCCGACGACGA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1134482-1135876	Sequence	Blon_0960 - RNA polymerase sigma factor