Sequence retrieval

Genome: Bifidobacterium longum subsp. infantis ATCC 15697
Start position: 1419364
End position: 1419387
Length: 24

DNA sequence
>NC_011593, from 1419364 to 1419387 (24 bp); Bifidobacterium longum subsp. infantis ATCC 15697 GCGTGAGCATGAGCGTCAGCGCGA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1419231-1419632	Sequence	Blon_1235 - hypothetical protein (Protein is coded in complementary strand; from 1419632 to 1419231)