Sequence retrieval

Genome: Bifidobacterium longum subsp. infantis ATCC 15697
Start position: 1429999
End position: 1430022
Length: 24

DNA sequence
>NC_011593, from 1429999 to 1430022 (24 bp); Bifidobacterium longum subsp. infantis ATCC 15697 CGGCGTGGGCGTGGGCGTCGGCGT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1429940-1431256	Sequence	Blon_1244 - hypothetical protein (Protein is coded in complementary strand; from 1431256 to 1429940)