Sequence retrieval

Genome: Bifidobacterium longum subsp. infantis ATCC 15697
Start position: 2377686
End position: 2377709
Length: 24

DNA sequence
>NC_011593, from 2377686 to 2377709 (24 bp); Bifidobacterium longum subsp. infantis ATCC 15697 GCAGCGGCACCGGCAGCAGCAGCC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2377662-2378402	Sequence	Blon_2152 gpmA phosphoglyceromutase (Protein is coded in complementary strand; from 2378402 to 2377662)