Sequence retrieval

Genome: Bifidobacterium longum subsp. infantis ATCC 15697
Start position: 444985
End position: 445008
Length: 24

DNA sequence
>NC_011593, from 444985 to 445008 (24 bp); Bifidobacterium longum subsp. infantis ATCC 15697 GGCGCGGACGCGGGCCCGGGCGCA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 444231-445028	Sequence	Blon_0384 - aminotransferase, class IV