Sequence retrieval

Genome: Bifidobacterium longum subsp. infantis ATCC 15697
Start position: 592353
End position: 592376
Length: 24

DNA sequence
>NC_011593, from 592353 to 592376 (24 bp); Bifidobacterium longum subsp. infantis ATCC 15697 GGTGGTGCTGGTGTTGGTGATGGT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 591772-596214	Sequence	Blon_0524 - LPXTG-motif cell wall anchor domain-containing protein (Protein is coded in complementary strand; from 596214 to 591772)