Sequence retrieval

Genome: Bifidobacterium longum subsp. infantis ATCC 15697
Start position: 600618
End position: 600641
Length: 24

DNA sequence
>NC_011593, from 600618 to 600641 (24 bp); Bifidobacterium longum subsp. infantis ATCC 15697 TTGTTTGAATGTTTGATTGTCTGA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 600571-601098	Sequence	Blon_0531 - transcription factor WhiB (Protein is coded in complementary strand; from 601098 to 600571)