Sequence retrieval

Genome: Bifidobacterium longum subsp. infantis ATCC 15697
Start position: 667638
End position: 667661
Length: 24

DNA sequence
>NC_011593, from 667638 to 667661 (24 bp); Bifidobacterium longum subsp. infantis ATCC 15697 GGCAACGGTAACGGCAATGCCAAC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 667246-667989	Sequence	Blon_0590 - single-strand binding protein