Sequence retrieval

Genome: Bifidobacterium longum subsp. infantis ATCC 15697
Start position: 791131
End position: 791154
Length: 24

DNA sequence
>NC_011593, from 791131 to 791154 (24 bp); Bifidobacterium longum subsp. infantis ATCC 15697 GCCAGCGCCAGCGCAAGCACCAGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 790300-791358	Sequence	Blon_0687 - hypothetical protein (Protein is coded in complementary strand; from 791358 to 790300)