Sequence retrieval

Genome: Bifidobacterium longum subsp. infantis ATCC 15697
Start position: 898020
End position: 898043
Length: 24

DNA sequence
>NC_011593, from 898020 to 898043 (24 bp); Bifidobacterium longum subsp. infantis ATCC 15697 GCGGCGGCGTCGGCGGAGGCGTCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 897240-898976	Sequence	Blon_0775 - hypothetical protein (Protein is coded in complementary strand; from 898976 to 897240)