Sequence retrieval

Genome: Bifidobacterium longum subsp. infantis ATCC 15697
Start position: 90250
End position: 90273
Length: 24

DNA sequence
>NC_011593, from 90250 to 90273 (24 bp); Bifidobacterium longum subsp. infantis ATCC 15697 GCGTTGCCGTTGCCGTTGCCGTTG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 90202-92289	Sequence	Blon_0077 - protein kinase (Protein is coded in complementary strand; from 92289 to 90202)