Sequence retrieval

Genome: Bifidobacterium longum subsp. infantis ATCC 15697
Start position: 1383656
End position: 1383680
Length: 25

DNA sequence
>NC_011593, from 1383656 to 1383680 (25 bp); Bifidobacterium longum subsp. infantis ATCC 15697 GGCGGGGCGTGGGGGGGGGGAGCGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1383619-1384392	Sequence	Blon_1198 - hypothetical protein (Protein is coded in complementary strand; from 1384392 to 1383619)