Sequence retrieval

Genome: Bifidobacterium longum subsp. infantis ATCC 15697
Start position: 1635237
End position: 1635263
Length: 27

DNA sequence
>NC_011593, from 1635237 to 1635263 (27 bp); Bifidobacterium longum subsp. infantis ATCC 15697 ACTTCTCCAGCTTCTCCAACTTTTCCA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1635236-1635781	Sequence	Blon_1472 - alkyl hydroperoxide reductase (Protein is coded in complementary strand; from 1635781 to 1635236)