Sequence retrieval

Genome: Bifidobacterium longum subsp. infantis ATCC 15697
Start position: 2659040
End position: 2659066
Length: 27

DNA sequence
>NC_011593, from 2659040 to 2659066 (27 bp); Bifidobacterium longum subsp. infantis ATCC 15697 GCATTCTTCGCATTGTTCCCATTCTTC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2658408-2660111	Sequence	Blon_2383 - hypothetical protein