Sequence retrieval

Genome: Bifidobacterium longum subsp. infantis ATCC 15697
Start position: 1200322
End position: 1200351
Length: 30

DNA sequence
>NC_011593, from 1200322 to 1200351 (30 bp); Bifidobacterium longum subsp. infantis ATCC 15697 AGAATCAGCCAGACTCACCCGGGATCAGCC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1200075-1200854	Sequence	Blon_1013 - competence protein ComEA