Sequence retrieval

Genome: Bifidobacterium longum subsp. infantis ATCC 15697
Start position: 2533830
End position: 2533859
Length: 30

DNA sequence
>NC_011593, from 2533830 to 2533859 (30 bp); Bifidobacterium longum subsp. infantis ATCC 15697 CATCGGCATCAGCATCAGCATCAGCATCAG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2533442-2534359	Sequence	Blon_2288 - biotin--acetyl-CoA-carboxylase ligase (Protein is coded in complementary strand; from 2534359 to 2533442)