Sequence retrieval

Genome: Bifidobacterium longum subsp. infantis ATCC 15697
Start position: 1519594
End position: 1519626
Length: 33

DNA sequence
>NC_011593, from 1519594 to 1519626 (33 bp); Bifidobacterium longum subsp. infantis ATCC 15697 GCGTGTGCCGAGCGTGTGCCTATCGTGTGCCTA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1518316-1519680	Sequence	Blon_1348 - phage integrase family protein (Protein is coded in complementary strand; from 1519680 to 1518316)