Sequence retrieval

Genome: Bifidobacterium longum subsp. infantis ATCC 15697
Start position: 2211990
End position: 2212025
Length: 36

DNA sequence
>NC_011593, from 2211990 to 2212025 (36 bp); Bifidobacterium longum subsp. infantis ATCC 15697 CGGCGCCGGAGCCGGAGCCGGAGCGGGCGCCGGAGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2211595-2212956	Sequence	Blon_2024 - CHAP protein (Protein is coded in complementary strand; from 2212956 to 2211595)