Sequence retrieval

Genome: Bifidobacterium longum subsp. infantis ATCC 15697
Start position: 2401396
End position: 2401431
Length: 36

DNA sequence
>NC_011593, from 2401396 to 2401431 (36 bp); Bifidobacterium longum subsp. infantis ATCC 15697 CGCCGGGCACCGCGCCGGGCACCGCGCCGGTCACCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2400357-2402060	Sequence	Blon_2168 - phage shock protein C, PspC (Protein is coded in complementary strand; from 2402060 to 2400357)