Sequence retrieval

Genome: Bifidobacterium longum subsp. infantis ATCC 15697
Start position: 482597
End position: 482641
Length: 45

DNA sequence
>NC_011593, from 482597 to 482641 (45 bp); Bifidobacterium longum subsp. infantis ATCC 15697 CTGATGCGTCCGTGACGGATGCGTCCGTGACGGGTGCGTTCGTGA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 482074-483486	Sequence	Blon_0418 - ABC transporter (Protein is coded in complementary strand; from 483486 to 482074)