Sequence retrieval

Genome: Bifidobacterium longum subsp. infantis ATCC 15697
Start position: 1085768
End position: 1085821
Length: 54

DNA sequence
>NC_011593, from 1085768 to 1085821 (54 bp); Bifidobacterium longum subsp. infantis ATCC 15697 CGTCCAACTGCGCCCCGCCATGTAACTGCGCCCCGCCATGTAACTGCGCCCCGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF.. 1084729-1085793	Sequence	Blon_0919 - prephenate dehydrogenase