Sequence retrieval

Genome: Bifidobacterium longum subsp. infantis ATCC 15697
Start position: 224991
End position: 225062
Length: 72

DNA sequence
>NC_011593, from 224991 to 225062 (72 bp); Bifidobacterium longum subsp. infantis ATCC 15697 CTGTGGGTTCTGCCCATACTGCTGGTTCTGCCCATACTGCTGGTTCTGCCCGTATTGTGGGTTCTGCCCA TA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 224893-226020	Sequence	Blon_0189 - hypothetical protein (Protein is coded in complementary strand; from 226020 to 224893)