Sequence retrieval

Genome: Bacillus cereus AH187
Start position: 2442100
End position: 2442123
Length: 24

DNA sequence
>NC_011658, from 2442100 to 2442123 (24 bp); Bacillus cereus AH187 AAAGATAAAAATATAAAACGATAA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2441163-2442179	Sequence	BCAH187_A2615 - D-alanyl-D-alanine carboxypeptidase family protein (Protein is coded in complementary strand; from 2442179 to 2441163)