Sequence retrieval

Genome: Bacillus cereus AH187
Start position: 2686285
End position: 2686308
Length: 24

DNA sequence
>NC_011658, from 2686285 to 2686308 (24 bp); Bacillus cereus AH187 ATAAATATAAACATGAATATAAAT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2686048-2686404	Sequence	BCAH187_A2900 divIC2 cell division protein DivIC (Protein is coded in complementary strand; from 2686404 to 2686048)