Sequence retrieval

Genome: Bacillus cereus AH187
Start position: 2780511
End position: 2780534
Length: 24

DNA sequence
>NC_011658, from 2780511 to 2780534 (24 bp); Bacillus cereus AH187 TGCTTTTGCTTCTTCTTTAGCTTT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2779870-2781516	Sequence	BCAH187_A3009 - enterotoxin (Protein is coded in complementary strand; from 2781516 to 2779870)