Sequence retrieval

Genome: Bacillus cereus AH187
Start position: 2865199
End position: 2865222
Length: 24

DNA sequence
>NC_011658, from 2865199 to 2865222 (24 bp); Bacillus cereus AH187 TCACTTGCACTTTCTCTTTCAATT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2864680-2865606	Sequence	BCAH187_A3097 - hypothetical protein (Protein is coded in complementary strand; from 2865606 to 2864680)