Sequence retrieval

Genome: Bacillus cereus AH187
Start position: 3642174
End position: 3642197
Length: 24

DNA sequence
>NC_011658, from 3642174 to 3642197 (24 bp); Bacillus cereus AH187 CAATTCCAACTCCAATTGCAATTG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3641804-3642577	Sequence	BCAH187_A3884 rnhB ribonuclease HII (Protein is coded in complementary strand; from 3642577 to 3641804)