Sequence retrieval

Genome: Bacillus cereus AH187
Start position: 3697104
End position: 3697127
Length: 24

DNA sequence
>NC_011658, from 3697104 to 3697127 (24 bp); Bacillus cereus AH187 AATCTTCAAACCTTCAAATCTTCC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3696640-3697554	Sequence	BCAH187_A3938 pyrB aspartate carbamoyltransferase catalytic subunit (Protein is coded in complementary strand; from 3697554 to 3696640)