Sequence retrieval

Genome: Bacillus cereus AH187
Start position: 3820418
End position: 3820441
Length: 24

DNA sequence
>NC_011658, from 3820418 to 3820441 (24 bp); Bacillus cereus AH187 CAAGTGCAAGTCCAACTGCAAGTC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3819658-3820635	Sequence	BCAH187_A4090 pdhB pyruvate dehydrogenase complex E1 component subunit beta (Protein is coded in complementary strand; from 3820635 to 3819658)