Sequence retrieval

Genome: Bacillus cereus AH187
Start position: 4256647
End position: 4256670
Length: 24

DNA sequence
>NC_011658, from 4256647 to 4256670 (24 bp); Bacillus cereus AH187 AAATAATAAAATAAGAAAATAAAA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 4256520-4256927	Sequence	BCAH187_A4592 - hypothetical protein (Protein is coded in complementary strand; from 4256927 to 4256520)