Sequence retrieval

Genome: Bacillus cereus AH187
Start position: 4415592
End position: 4415615
Length: 24

DNA sequence
>NC_011658, from 4415592 to 4415615 (24 bp); Bacillus cereus AH187 TATTCTCTTATGCTCTTGTTCTCT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 4415326-4416021	Sequence	BCAH187_A4760 - hypothetical protein (Protein is coded in complementary strand; from 4416021 to 4415326)