Sequence retrieval

Genome: Bacillus cereus AH187
Start position: 5064918
End position: 5064941
Length: 24

DNA sequence
>NC_011658, from 5064918 to 5064941 (24 bp); Bacillus cereus AH187 GCCTTCGCTTTCGCCTTGGCCTTT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 5064252-5065517	Sequence	BCAH187_A5474 - NADH dehydrogenase subunit C (Protein is coded in complementary strand; from 5065517 to 5064252)