Sequence retrieval

Genome: Bacillus cereus AH187
Start position: 691308
End position: 691331
Length: 24

DNA sequence
>NC_011658, from 691308 to 691331 (24 bp); Bacillus cereus AH187 CTTTTTCTTCTTGTTTTTCTTCTT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 690539-692158	Sequence	BCAH187_A0739 lldP1 L-lactate permease (Protein is coded in complementary strand; from 692158 to 690539)