Sequence retrieval

Genome: Bacillus cereus AH187
Start position: 3268919
End position: 3268943
Length: 25

DNA sequence
>NC_011658, from 3268919 to 3268943 (25 bp); Bacillus cereus AH187 TCTTTTATTTTCTTGTTTTTTCTAT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3268913-3270133	Sequence	BCAH187_A3521 - major facilitator family transporter (Protein is coded in complementary strand; from 3270133 to 3268913)