Sequence retrieval

Genome: Bacillus cereus AH187
Start position: 4397360
End position: 4397384
Length: 25

DNA sequence
>NC_011658, from 4397360 to 4397384 (25 bp); Bacillus cereus AH187 TAAAACAAAATAAAGTTAAAGAAAA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 4397300-4397623	Sequence	BCAH187_A4738 - hypothetical protein (Protein is coded in complementary strand; from 4397623 to 4397300)