Sequence retrieval

Genome: Bacillus cereus AH187
Start position: 5047452
End position: 5047476
Length: 25

DNA sequence
>NC_011658, from 5047452 to 5047476 (25 bp); Bacillus cereus AH187 TTCTTTTCTATACTTTTGTTTTGTT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 5047426-5047632	Sequence	BCAH187_A5456 spoIIID stage III sporulation protein D (Protein is coded in complementary strand; from 5047632 to 5047426)