Sequence retrieval

Genome: Bacillus cereus AH187
Start position: 1320634
End position: 1320660
Length: 27

DNA sequence
>NC_011658, from 1320634 to 1320660 (27 bp); Bacillus cereus AH187 TTTCGGTTCTTTTGGTTCTTGCGGTTC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1320263-1320694	Sequence	BCAH187_A1409 - hypothetical protein (Protein is coded in complementary strand; from 1320694 to 1320263)